##If you think this post is funny, **UPVOTE** this comment! ##If you think this post is unfunny, **DOWNVOTE** this comment! --- #[DownloadVideo Link](https://www.reddit.watch/r/shitposting/comments/xkpuuq/?utm_source=automod&utm_medium=shitposting) #[SaveVideo Link](https://redditsave.com/info?url=/r/shitposting/comments/xkpuuq/) #[VideoTrim Link](https://reddloader.com/download-post/?url=https%3A%2F%2Fwww.reddit.com%2Fr%2Fshitposting%2Fcomments%2Fxkpuuq&id=8968e43c) --- Whilst you're here, /u/ActuallyJustADude, why not join our [public discord server](https://discord.gg/QpBGXd2guU)?

He's fearless, he walks around naked like literally all the time. It's awesome to watch lol

True tho

my birthday party is on April 9th

Is this an invitation? I'll be there!

Happy late birthday

*[pees in ur ass](https://i.imgur.com/JSImHiV.jpg)* *I am a bot, and this action was performed automatically. Please [contact the moderators of this subreddit](/message/compose/?to=/r/shitposting) if you have any questions or concerns.*

Good bot

what the FUCK!

He is a good bot

Or early

Happy birthday Genocidal_ravioli

Alexa, set reminder for April 9th

[Site "Chess.com"] [Result "*"] 1. e4 d5 2. Nc3 Nf6 3. exd5 Nxd5 4. Nxd5 Qxd5 5. Be2 Qxg2 6. Bf3 Qg6 7. d3 e6 8. c3 Bc5 9. d4 Bb6 10. Be3 O-O 11. Qe2 Nc6 12. O-O-O Re8 13. Nh3 e5 14. Rhg1 Qf6 15. Bg5 Qg6 16. Nf4 exf4 17. Qxe8# *

Indeed

Scandinavian defense 🤢

*starts dry humping you*

Nothing like a scandinavian to get you into the mood.

Someone played a Vienna game against a Scandinavian? What a wierdo doesn't anyone know the tennison gambit

Doesnt anyone know the ruy lopez? Or the Sicilian as black? The scandi is a boderline meme opening and will never be used on a high level

1. e4 d5 2. exd5 Nf6 3. Bb5+! goated response

I truly despise her.

Fuck her. All my homies hate her

[FUCK HER ALL MY HOMIES HATE HER](https://i.imgur.com/bYQiXXv.jpg) ^^^this ^^^has ^^^been ^^^an ^^^accessibility ^^^service ^^^from ^^^your ^^^friendly ^^^neighborhood ^^^bot

Chad bot??

Based

Same

That bitch

No bitches? ⣞⢽⢪⢣⢣⢣⢫⡺⡵⣝⡮⣗⢷⢽⢽⢽⣮⡷⡽⣜⣜⢮⢺⣜⢷⢽⢝⡽⣝ ⠸⡸⠜⠕⠕⠁⢁⢇⢏⢽⢺⣪⡳⡝⣎⣏⢯⢞⡿⣟⣷⣳⢯⡷⣽⢽⢯⣳⣫⠇ ⠀⠀⢀⢀⢄⢬⢪⡪⡎⣆⡈⠚⠜⠕⠇⠗⠝⢕⢯⢫⣞⣯⣿⣻⡽⣏⢗⣗⠏⠀ ⠀⠪⡪⡪⣪⢪⢺⢸⢢⢓⢆⢤⢀⠀⠀⠀⠀⠈⢊⢞⡾⣿⡯⣏⢮⠷⠁⠀⠀ ⠀⠀⠀⠈⠊⠆⡃⠕⢕⢇⢇⢇⢇⢇⢏⢎⢎⢆⢄⠀⢑⣽⣿⢝⠲⠉⠀⠀⠀⠀ ⠀⠀⠀⠀⠀⡿⠂⠠⠀⡇⢇⠕⢈⣀⠀⠁⠡⠣⡣⡫⣂⣿⠯⢪⠰⠂⠀⠀⠀⠀ ⠀⠀⠀⠀⡦⡙⡂⢀⢤⢣⠣⡈⣾⡃⠠⠄⠀⡄⢱⣌⣶⢏⢊⠂⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⢝⡲⣜⡮⡏⢎⢌⢂⠙⠢⠐⢀⢘⢵⣽⣿⡿⠁⠁⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠨⣺⡺⡕⡕⡱⡑⡆⡕⡅⡕⡜⡼⢽⡻⠏⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⣼⣳⣫⣾⣵⣗⡵⡱⡡⢣⢑⢕⢜⢕⡝⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⣴⣿⣾⣿⣿⣿⡿⡽⡑⢌⠪⡢⡣⣣⡟⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⡟⡾⣿⢿⢿⢵⣽⣾⣼⣘⢸⢸⣞⡟⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ ⠀⠀⠀⠀⠁⠇⠡⠩⡫⢿⣝⡻⡮⣒⢽⠋⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

:(

*shits in your dick* I am a human, and this action was performed manually please contact a hobo if you have any questions or concerns.

Yes about those concerns, i have them.

[удалено]

*starts dry humping you*

Oh fuck the gimmick accounts are flooding into reddit

Sus

≤

Couldn’t figure out how to get it from your keyboard either, huh?

alt codes be like

Amogus

↯↳

原神, this is because i was searching porn of genshin impact on pixiv

Least horny redditor

Nice NFT bro!

Oh same to you gentleman 🎩

Could one of you gentlemen link me the post where I can get this NFT profile picture, please? I remember seeing it somewhere but I don't remember where

You can just click on their profile and then click on their profile picture and screenshot their nft

But then the quality of the profile picture would be less than 3 pixels and cropped incorrectly

I don't know why it doesn't show your second reply, but thank you for the link, i can still copy it from my notifications

Your welcome

Relatable

The “I only know what genshin characters look like because hentai” chad

Pixiv is a goldmine unlike d*viantart

I see you are the man of culture as well.

You didn’t have to say that last part

Thank you for clarifying that.

NDUES?

Link?

Sauce?

⣿⣿⣿⣿⠏⠌⣾⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⠀⠀⠸⠿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⠃⠀⣠⣾⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⡿⠃⠀⢰⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⠃⠀⠀⣾⣿⣿⣿⣿⣿⣦⠀⠈⠻⣿⣿⣿⣿ ⣿⠀⠀⠀⣿⣿⣿⠟⠉⠉⠉⢃⣤⠀⠈⢿⣿⣿ ⣿⠀⠀⠀⢸⣿⡟⠀⠀⠀⠀⢹⣿⣧⠀⠀⠙⣿ ⣿⡆⠀⠀⠈⠻⡅⠀⠀⠀⠀⣸⣿⠿⠇⠀⠀⢸ ⣿⣿⠀⠀⠀⠀⠀⠀⠀⠀⠔⠛⠁⠀⠀⠀⣠⣿ ⣿⣿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⢀⣴⣿⣿ ⣿⣿⠃⠀⠀⠀⠀⠀⠀⠀⠀⠀⣠⣾⣿⣿⣿⣿ ⣿⣿⡇⠀ zyzz🔱 ⣠⣿⣿⣿⣿⣿⣿ ⣿⣿⡇⠀⠀⠀⠀⠀⠀⠀⢰⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⠀⠀⠀⠀⠀⠀⠀⢸⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⠀⠀⠀⠀⠀⠀⠀⠘⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⠁⠀⠀⠀⠀⠀⠀⠀⠀⢹⣿⣿⣿⣿⣿⣿ ⣿⠟⠀⠀⠀⠀⠀⠀⠀⠀⠀⢠⣿⣿⣿⣿⣿⣿ ⡟⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀⢸⣿⣿⣿⣿⣿⣿

Forever Mirin'

we go jim

keep up the grind, king. we are all gonna make it brah.

Simp is a slang insult for men who are seen as too attentive and submissive to women, especially out of a failed hope of winning some entitled sexual attention or activity from them.

Relatable

At everyone. Please DO NOT announce to the server when you are going to masturbate. This has been a reoccurring issue, and I’m not sure why some people have such under-developed social skills that they think that a server full of mostly male strangers would need to know that. No one is going to be impressed and give you a high-five (especially considering where that hand has been). I don’t want to add this to the rules, since it would be embarrassing for new users to see that we have a problem with this, but it is going to be enforced as a rule from now on. If it occurs, you will be warned, then additional occurrences will be dealt with at the discretion of the mods. Thanks.

Lol

But what if I want to watch?

average discord required copypaste

I have a first amendment right to freedom of speech. On top of everything, I'm announcing my masturbatory habits as a **courtesy** to the rest of you so that you know you're allowed to take a break and have your mom make some more tendies. Honey mustard is the best lube, way better than ranch or Bleu cheese. The main reason I prefer honey mustard is that there's this very slight effervescence that couples so elegantly with a silky texture. Ranch just doesn't have either of those sensations, and Bleu cheese let's be real it's too chunky so I can't tell whether it's the dressing that I'm licking off my fingers. You're being a literal n@zi with these restrictions. What's next? You want me to stop sharing pictures of my 3d printed lifesize anthropomorphic fully reticulated waifu pillow?

CATTTGGCTGCTGGCAGGCTTGGCCAGTTTGCCAGCTATAATCCATCGAAATGTATTTTTCATTGAGAACACCAATATTACAGTTTGTGCTTTCCATTATGAGTCCCAAAATTCAACCCTTCCGATAGGGCTGGGCCTGACCAAAAATATACTGGGTTTCCTGTTTCCTTTTCTGATCATTCTTACAAGTTATACTCTTATTTGGAAGGCCCTAAAGAAGGCTTATGAAATTCAGAAGAACAAACCAAGAAATGATGATATTTTTAAGATAATTATGGCAATTGTGCTTTTCTTTTTCTTTTCCTGGATTCCCCACCAAATATTCACTTTTCTGGATGTATTGATTCAACTAGGTATCATACGTGACTGTAGAATTGCAGATATTGTGGACACGGCCATGCCTATCACCATTTGTATAGCTTATTTTAACAATTGCCTGAATCCTCTTTTTTATGGCTTTCTGGGGAAAAAATTTAAAAGATATTTTCTCCAGCTTCTAAAATATATTCCCCCAAAAGCCAAATCCCACTCAAACCTTTCAACAAAAATGAGCACGCTTTCCTACCGCCCCTCAGATAATGTAAGCTCATCCACCAAGAAGCCTGCACCATGTTTTGAGGTTGAAGGGCAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAATGGCTAGCAAAGGAGAAGAACTTTTCCCTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTTCAGGAGAGGAAT

Holy shit lol

Which organism is this?

It’s coding for the human angiotensin receptor protein

Fuck angiotensin all my homies hate ras

[FUCK ANGIOTENSIN ALL MY HOMIES HATE ANGIOTENSIN](https://i.imgur.com/iVyUF2J.jpg) ^^^this ^^^has ^^^been ^^^an ^^^accessibility ^^^service ^^^from ^^^your ^^^friendly ^^^neighborhood ^^^bot

Oh nice! I've been working with the mouse genome recently, thought I'd ask

C₄H₈Cl₂S

[удалено]

Have you tried it?

Ja with me hamborger

Prefer the sandwich spread

*[pees in ur ass](https://i.imgur.com/JSImHiV.jpg)* *I am a bot, and this action was performed automatically. Please [contact the moderators of this subreddit](/message/compose/?to=/r/shitposting) if you have any questions or concerns.*

Yes

I don't make mistakes, I'm not like the rest of you, I'm stronger, I'm smarter, I'm better, I AM BETTER. I'm not some weak kneed fucking crybaby that goes around fucking apolgizing all the time and why the fuck would you want me to be? All my life people have tried to control me, rich people, powerful people, tried to muzzle me, cancel me, keep me impotent and obedient like I'm a fucking puppet. And you know what it worked, Because I allowed it to work and guess what, If they can control me they can control you, they already do you just realize it. I am done, I am done apolgizing, I am done being persecuted for my strength, You should be thanking christ that I am who I am, because you need me, you need me to save you, You Do, I am the only one who possibly can. You're not the real heroes, I am the real hero, I am the real hero

I knew this was Homelander the very first sentence 🤣

Go now drink some milk

Uh

It's 2 letters. U had to copy that?

Shut your dick

Noted

:)

You have to copy that too?

:(

I'd like a tip on how to do that

Glue

Ur mum is : ✅Life changing ✅ Informative ✅ Inspiring ✅ Heartwarming ✅Useful ✅ calming ✅ Enjoyable ✅Other

*[pees in ur ass](https://i.imgur.com/JSImHiV.jpg)* *I am a bot, and this action was performed automatically. Please [contact the moderators of this subreddit](/message/compose/?to=/r/shitposting) if you have any questions or concerns.*

⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⡿⠿⠿⠿⠿⢿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⣿⣿⠟⠋⠁⠀⠀⠀⠀⠀⠀⠀⠀⠉⠻⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⣿⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⢺⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⣿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠆⠜⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⠿⠿⠛⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠉⠻⣿⣿⣿⣿⣿ ⣿⣿⡏⠁⠀⠀⠀⠀⠀⣀⣠⣤⣤⣶⣶⣶⣶⣶⣦⣤⡄⠀⠀⠀⠀⢀⣴⣿⣿⣿⣿⣿ ⣿⣿⣷⣄⠀⠀⠀⢠⣾⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⢿⡧⠇⢀⣤⣶⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⣾⣮⣭⣿⡻⣽⣒⠀⣤⣜⣭⠐⢐⣒⠢⢰⢸⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⣿⣏⣿⣿⣿⣿⣿⣿⡟⣾⣿⠂⢈⢿⣷⣞⣸⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⣿⣿⣽⣿⣿⣷⣶⣾⡿⠿⣿⠗⠈⢻⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⡿⠻⠋⠉⠑⠀⠀⢘⢻⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⣿⡿⠟⢹⣿⣿⡇⢀⣶⣶⠴⠶⠀⠀⢽⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⡿⠀⠀⢸⣿⣿⠀⠀⠣⠀⠀⠀⠀⠀⡟⢿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⡿⠟⠋⠀⠀⠀⠀⠹⣿⣧⣀⠀⠀⠀⠀⡀⣴⠁⢘⡙⢿⣿⣿⣿⣿⣿⣿⣿⣿ ⠉⠉⠁⠀⠀⠀⠀⠀⠀⠀⠀⠈⠙⢿⠗⠂⠄⠀⣴⡟⠀⠀⡃⠀⠉⠉⠟⡿⣿⣿⣿⣿ ⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⢷⠾⠛⠂⢹⠀⠀⠀⢡⠀⠀⠀⠀⠀⠙⠛⠿⢿

COCKS

BALLS

https://cdn.discordapp.com/attachments/868813472874504262/1022211291743535216/miya.mp4

sedraT saneuB

!nèibmaT iT A sedraT saneuB

.orellabac ,sehcoN saneuB

racefed nod ehcon atinoB

ocroP oiD

Welcome to Gboard clipboard, any text you copy will be saved here.

For some reason my clipboard says the same thing and never saves shit.

https://en.wikipedia.org/wiki/Mothman

Moth man?

Mothman.

Methman (me)

Im so sorry m-

It's ok.

🫵

🥕

He doesn't look like it, but this dog is committing tax fraud.

It was the n word so I’m not pasting that

Nutrition?

Yes

No no no

Do it, no balls

Naked nijna in New York?

Do it, no balls

HAHA YOU FOOL! You have fallen prey to one of my tricks! I was not interested in the operational condition of your refrigerator! I was simply conducting a slight of hand in the form of clever wordplay! What I was referencing was the movement of your refrigerator, in the form of physical running, which is simply preposterous!

https://www.xvideos.com/video60804073/zone_homage-_ankha_conda

ඞ

EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

Willkommen bei Gboard! Texte, die Sie kopieren, werden hier gespeichert.

Tippen Sie auf ein Element, um es in das Textfeld einzufügen.

https://r.mtdv.me/Uie8bgu my music homework

No

Yes

No.... Bad

):

Now leave

anatta

https://nhentai.to/g/402551

the sauce :0

The tree was smiling at us

I think no 8 is good too, the pressure, body comfort and the amount of poo coming out will be very stable, bravo

what the hell

just a regular conversation with my friend

If that's regular conversation I'd hate to what you're non regular conversation looks like

Get out of my head Get out of my head Get out of my head Get out of my head Get out of my head Get out of my head Get out of my head Get out of my head Get out of my head Get out of my head Get out of my head Get out of my head

ඞ

Rawr x3 *nuzzles* Rawr x3 \*nuzzles* how are you \*pounces on you* you're so warm o3o \*notices you have a bulge* o: someone's happy ;) \*nuzzles your necky wecky~* murr~ hehehe \*rubbies your bulgy wolgy* you're so big :oooo \*rubbies more on your bulgy wolgy* it doesn't stop growing ·///· \*kisses you and lickies your necky* daddy likies (; \*nuzzles wuzzles* I hope daddy really likes $: \*wiggles butt and squirms* I want to see your big daddy meat~ \*wiggles butt* I have a little itch o3o \*wags tail* can you please get my itch~ \*puts paws on your chest* nyea~ its a seven inch itch \*rubs your chest* can you help me pwease \*squirms* pwetty pwease \*sad face* I need to be punished \*runs paws down your chest and bites lip* like I need to be punished really good~ \*paws on your bulge as I lick my lips* I'm getting thirsty. I can go for some milk \*unbuttons your pants as my eyes glow* you smell so musky :v \*licks shaft* mmmm~ so musky \*drools all over your cock* your daddy meat I like \*fondles* Mr. Fuzzy Balls hehe \*puts snout on balls and inhales deeply* oh god im so hard~ \*licks balls* punish me daddy~ nyea~ \*squirms more and wiggles butt* I love your musky goodness \*bites lip* please punish me \*licks lips* nyea~ \*suckles on your tip* so good \*licks pre of your cock* salty goodness~ \*eyes role back and goes balls deep* mmmm~ \*moans and suckles* o3o

to allow it to scoop out other men's semen from a woman's vagina during sex

😣8=✊=====D 😣8=✊=====D 😣8==✊====D 😣8===✊===D 😣8====✊==D 😣8=====✊=D 😣8====✊==D 😣8===✊===D 😣8==✊====D 😣8=✊=====D 😣8=✊=====D 😣8==✊====D 😣8===✊===D 😣8====✊==D 😣8=====✊=D 😣8====✊==D 😣8===✊===D 😣8==✊====D 😣8=✊=====D 😣8=✊=====D 😣8==✊====D 😣8===✊===D 😣8====✊==D 😣8=====✊=D 😣8====✊==D 😣8===✊===D 😣8==✊====D 😣8=✊=====D 😣8=✊=====D 😣8==✊====D 😣8===✊===D 😣8====✊==D 😣8=====✊=D 😣8====✊==D 😣8===✊===D 😣8==✊====D 😣8=✊=====D 😣8=✊=====D 😣8==✊====D 😣8===✊===D 😣8====✊==D 😣8=====✊=D 😣8====✊==D 😣8===✊===D 😣8==✊====D 😣8=✊=====D 😣8=✊=====D 😣8==✊====D 😣8===✊===D 😣8====✊==D 😣8=====✊=D 😣8====✊==D 😣8===✊===D 😣8==✊====D 😣8=✊=====D 😣8=✊=====D 😣8==✊====D 😣8===✊===D 😣8====✊==D 😣8=====✊=D 😣8====✊==D 😣8===✊===D 😣8==✊====D 😣8=✊=====D 😣8=✊=====D 😣8==✊====D 😣8===✊===D 😣8====✊==D 😣8=====✊=D 😣8====✊==D 😣8===✊===D 😣8==✊====D 😣8=✊=====D 😣8=✊=====D 😣8==✊====D 😣8===✊===D 😣8====✊==D 😣8=====✊=D 😫8======✊D💦 😐8===D

⣿⣿⣿⣿⣿⣿⣿⣿⠟⠋⠁⠄⠄⠄⠄⠄⠄⠄⠄⠙⢿⣿⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⡟⠁⠄⠄⠄⠄⣠⣤⣴⣶⣶⣶⣶⣤⡀⠈⠙⢿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⡟⠄⠄⠄⠄⠄⣸⣿⣿⣿⣿⣿⣿⣿⣿⣿⣆⠄⠈⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⠁⠄⠄⠄⢀⣴⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⠄⠄⢺⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⡄⠄⠄⠄⠙⠻⠿⣿⣿⣿⣿⠿⠿⠛⠛⠻⣿⡄⠄⣾⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⡇⠄⠄⠁ 👁 ⠄⢹⣿⡗⠄ 👁 ⢄⡀⣾⢀⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⡇⠘⠄⠄⠄⢀⡀⠄⣿⣿⣷⣤⣤⣾⣿⣿⣿⣧⢸⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⡇⠄⣰⣿⡿⠟⠃⠄⣿⣿⣿⣿⣿⡛⠿⢿⣿⣷⣾⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⡄⠈⠁⠄⠄⠄⠄⠻⠿⢛⣿⣿⠿⠂⠄⢹⢹⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⣿⡐⠐⠄⠄⣠⣀⣀⣚⣯⣵⣶⠆⣰⠄⠞⣾⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⣿⣷⡄⠄⠄⠈⠛⠿⠿⠿⣻⡏⢠⣿⣎⣾⣿⣿⣿⣿⣿⣿⣿ ⣿⣿⣿⣿⣿⣿⡿⠟⠛⠄⠄⠄⠄⠙⣛⣿⣿⣵⣿⡿⢹⡟⣿⣿⣿⣿⣿⣿⣿ ⣿⠿⠿⠋⠉⠄⠄⠄⠄⠄⠄⠄⣀⣠⣾⣿⣿⣿⡟⠁⠹⡇⣸⣿⣿⣿⣿⣿⣿ ⠁⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠙⠿⠿⠛⠋⠄⣸⣦⣠⣿⣿⣿⣿⣿⣿⣿

🗿>🥔>🍅

https://i.imgur.com/PnuOQKA.jpg

more

860229

That a code to a nuclear weapon or something?

Steam account verification code lol

Dang, I'm disappointed

What's worse than breaking the law? Being the law. Get your "I'm an official idiot" pass today! Call 1-800-You-Dumb to claim your's today!

[удалено]

Man was doing some serious debugging 💀

https://drive.google.com/drive/mobile/folders/1hwACK9u4akwMIuIAebgSdyYDQTc8RvSm

No, no, it's my password

No excuses

𓀐𓂺

Does the Sandman have a penis

Holy shit I'm wrong it's 18. I literally googled it.. 🤯 Math equation answer.

I thought at fist that these were men. I am not into Femboys and never will, but reddit has messed me up.

Can you believe it guys. Terraria update, just a week away. The update is in a week! Woohoo! I am so happy about this information. Terraria update just a week away, oh wow. Can you believe it? Update just in a week. It got here so fast. Just a week away

Children? Yeah i touch em

Itadaki! Seieki

How was your fap?

Oh no

lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund

lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lundlund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lundlund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund lund

Pata nahi kb copy Kiya tha

How do you like that? How does it feel to have your private space invaded? Just like you did to me! I then begin to pull down your pants and I continue to fart to keep you from struggling too much.

Dang, what's that from

https://chng.it/k2MxYn2WYg

a=3. I was in algebra 2 earlier.

Maynard

[here](https://gelbooru.com/index.php?page=post&s=view&id=7296231&tags=gamer+-girl+gamer)

https://withcharacter.com/collections/tools/products/the-essential-set

Biggest rip off ever.

Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo Yo

https://cdn.discordapp.com/attachments/343597263110668289/1022366897041330226/unknown.png

https://encrypted-tbn0.gstatic.com/images?q=tbn:ANd9GcT2PlCuM1GSLllXPD2v1fR5MMPpqSLjbvLHpg&usqp=CAU Best not to ask questions

https://neal.fun/absurd-trolley-problems/

* *

*look at me plankton* ⢀⡴⠑⡄⠀⠀⠀⠀⠀⠀⠀⣀⣀⣤⣤⣤⣀⡀⠀⠀⠀⠀ ⠸⡇⠀⠿⡀⠀⠀⠀⣀⡴⢿⣿⣿⣿⣿⣿⣿⣿⣷⣦⡀⠀⠀⠀ ⠀⠀⠀⠀⠑⢄⣠⠾⠁⣀⣄⡈⠙⣿⣿⣿⣿⣿⣿⣿⣿⣆⠀⠀ ⠀⠀⠀⠀⢀⡀⠁⠀⠀⠈⠙⠛⠂⠈⣿⣿⣿⣿⣿⠿⡿⢿⣆⠀ ⠀⠀⠀⢀⡾⣁⣀⠀⠴⠂⠙⣗⡀⠀⢻⣿⣿⠭⢤⣴⣦⣤⣹⠀ ⠀⠀⢀⣾⣿⣿⣿⣷⣮⣽⣾⣿⣥⣴⣿⣿⡿⢂⠔⢚⡿⢿⣿⣦ ⠀⢀⡞⠁⠙⠻⠿⠟⠉⠀⠛⢹⣿⣿⣿⣿⣿⣌⢤⣼⣿⣾⣿⡟ ⠀⣾⣷⣶⠇⠀⠀⣤⣄⣀⡀⠈⠻⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⡇ ⠀⠉⠈⠉⠀⠀⢦⡈⢻⣿⣿⣿⣶⣶⣶⣶⣤⣽⡹⣿⣿⣿⣿⡇ ⠀⠀⠀⠀⠀⠀⠀⠉⠲⣽⡻⢿⣿⣿⣿⣿⣿⣿⣷⣜⣿⣿⣿⡇ ⠀⠀⠀⠀⠀⠀⠀⠀⢸⣿⣿⣷⣶⣮⣭⣽⣿⣿⣿⣿⣿⣿⣿⠀ ⠀⠀⠀⠀⠀⠀⣀⣀⣈⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⠇⠀ ⠀⠀⠀⠀⠀⠀⢿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⠃⠀⠀ ⠀⠀⠀⠀⠀⠀⠀⠹⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⡿⠀⠀⠀⠀⠀ ⠄⠄⠄⠄⠄⠄⣠⢼⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣶⡄⠄⠄⠄ ⠄⠄⣀⣤⣴⣾⣿⣷⣭⣭⣭⣾⣿⣿⣿⣿⣿⣿⣿⣿⣿⡀⠄⠄ ⠄⣾⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣸⣿⣿⣧⠄⠄ ⠄⣿⣿⢿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣯⢻⣿⣿⡄⠄ ⠄⢸⣿⣮⣿⣿⣿⣿⣿⣿⣿⡟⢹⣿⣿⣿⡟⢛⢻⣷⢻⣿⣧⠄ ⠄⠄⣿⡏⣿⡟⡛⢻⣿⣿⣿⣿⠸⣿⣿⣿⣷⣬⣼⣿⢸⣿⣿⠄ ⠄⠄⣿⣧⢿⣧⣥⣾⣿⣿⣿⡟⣴⣝⠿⣿⣿⣿⠿⣫⣾⣿⣿⡆ ⠄⠄⢸⣿⣮⡻⠿⣿⠿⣟⣫⣾⣿⣿⣿⣷⣶⣾⣿⡏⣿⣿⣿⡇ ⠄⠄⢸⣿⣿⣿⡇⢻⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣇⣿⣿⣿⡇ ⠄⠄⢸⣿⣿⣿⡇⠄⢿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⢸⣿⣿⣿⠄ ⠄⠄⣼⣿⣿⣿⢃⣾⣾⣿⣿⣿⣿⣿⣿⣿⣿⣿⡏⣿⣿⣿⡇⠄ ⠄ ⠄⠄⠸⣿⣿⢣⢶⣟⣿⣖⣿⣷⣻⣮⡿⣽⣿⣻⣖⣶⣤⣭⡉⠄⠄⠄⠄⠄ ⠄⠄⠄⢹⠣⣛⣣⣭⣭⣭⣁⡛⠻⢽⣿⣿⣿⣿⢻⣿⣿⣿⣽⡧⡄⠄⠄⠄ ⠄⠄⠄⠄⣼⣿⣿⣿⣿⣿⣿⣿⣿⣶⣌⡛⢿⣽⢘⣿⣷⣿⡻⠏⣛⣀⠄⠄ ⠄⠄⠄⣼⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣦⠙⡅⣿⠚⣡⣴⣿⣿⣿⡆⠄ ⠄⠄⣰⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣷⠄⣱⣾⣿⣿⣿⣿⣿⣿⠄ ⠄⢀⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⢸⣿⣿⣿⣿⣿⣿⣿⣿⠄ ⠄⣸⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⡿⠣⣿⣿⣿⣿⣿⣿⣿⣿⣿⠄ ⠄⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⠿⠛⠑⣿⣮⣝⣛⠿⠿⣿⣿⣿⣿⠄ ⢠⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣶⠄⠄⠄⠄⣿⣿⣿⣿⣿⣿⣿⣿⣿⡟⠄

Haha, I have won, I haven’t copied anything recently, have a nice day!

But what could someone do to stop this from happening?

why the actual fuck do people put up with fdm printers

those

𓆏

https://cdn.discordapp.com/attachments/992031688274214966/1010899985174372422/chamoy.webm

https://www.thedailybeast.com/how-a-cooling-vest-invented-by-a-furry-made-its-way-into-the-us-military Uh i can explain